Review



hslc9a6 aav expression plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Addgene inc hslc9a6 aav expression plasmid
    Hslc9a6 Aav Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 280 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pm41934608-171-2-8?v=Addgene+inc
    Average 97 stars, based on 280 article reviews
    hslc9a6 aav expression plasmid - by Bioz Stars, 2026-07
    97/100 stars

    Images



    Similar Products

    97
    Addgene inc hslc9a6 aav expression plasmid
    Hslc9a6 Aav Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pm41934608-171-2-8?v=Addgene+inc
    Average 97 stars, based on 1 article reviews
    hslc9a6 aav expression plasmid - by Bioz Stars, 2026-07
    97/100 stars
      Buy from Supplier

    94
    Addgene inc penn aav camkii hi gfp cre wpre sv40 aav9
    Penn Aav Camkii Hi Gfp Cre Wpre Sv40 Aav9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/bio_rxiv__64898__2026__03__22__713468-216-20-22?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    penn aav camkii hi gfp cre wpre sv40 aav9 - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    95
    Addgene inc aav gfp plasmid
    Assessment of Futile Creatine Cycle within mature brown adipocytes (A) Representative immunofluorescence images of iBAT transduced with <t>AAV-FLEX-GFP-FLAG.</t> Mature adipocytes were labelled with anti-Perilipin 1 (PLIN1) antibody (red), GFP-FLAG was labeled with anti-FLAG antibody (green). Nuclei were labelled with DAPI (blue). Scale bar, 100 μm. Figure adapted from figure 1d of Bunk et al. (B) Oxygen consumption rates basally and following sequential additions of noradrenaline (NA, 0.1 μM) and oligomycin (Oligo, 15 μM). SBI-425 (10 μM) was added at the start (n = 2 independent preparations/sex). Figure adapted from figure 5b of Bunk et al. Two-way ANOVA (Tukey’s post-hoc test). Data are represented as mean ± SEM.
    Aav Gfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pmc12803982-90-0-4?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    aav gfp plasmid - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    96
    Addgene inc aav9 paav cmv hi cre gfp wpre addgene addgene
    Assessment of Futile Creatine Cycle within mature brown adipocytes (A) Representative immunofluorescence images of iBAT transduced with <t>AAV-FLEX-GFP-FLAG.</t> Mature adipocytes were labelled with anti-Perilipin 1 (PLIN1) antibody (red), GFP-FLAG was labeled with anti-FLAG antibody (green). Nuclei were labelled with DAPI (blue). Scale bar, 100 μm. Figure adapted from figure 1d of Bunk et al. (B) Oxygen consumption rates basally and following sequential additions of noradrenaline (NA, 0.1 μM) and oligomycin (Oligo, 15 μM). SBI-425 (10 μM) was added at the start (n = 2 independent preparations/sex). Figure adapted from figure 5b of Bunk et al. Two-way ANOVA (Tukey’s post-hoc test). Data are represented as mean ± SEM.
    Aav9 Paav Cmv Hi Cre Gfp Wpre Addgene Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pm41860867-130-62-64?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    aav9 paav cmv hi cre gfp wpre addgene addgene - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    97
    Addgene inc addgene aav standards
    (A). Immunofluorescence (IF) images of in vivo AT2 transduction <t>using</t> <t>AAV9.</t> Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE <t>(AAV-SBase-intron)</t> system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.
    Addgene Aav Standards, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/bio_rxiv__64898__2026__03__13__711474-289-12-15?v=Addgene+inc
    Average 97 stars, based on 1 article reviews
    addgene aav standards - by Bioz Stars, 2026-07
    97/100 stars
      Buy from Supplier

    95
    Addgene inc addgene plasmid
    (A). Immunofluorescence (IF) images of in vivo AT2 transduction <t>using</t> <t>AAV9.</t> Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE <t>(AAV-SBase-intron)</t> system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pmc12926985-193-17-17?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    93
    Addgene inc paav cag gfp
    (A). Immunofluorescence (IF) images of in vivo AT2 transduction <t>using</t> <t>AAV9.</t> Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE <t>(AAV-SBase-intron)</t> system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.
    Paav Cag Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pm41730862-250-9-10?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    paav cag gfp - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc paav gfaabc1d gfp construct
    a An experimental scheme. b Latency to fall during rotarod training of control and Megf10 cKO (black: Megf10 fl/fl , n = 9 mice, red: Aldh1l1-CreERT2; Megf10 fl/fl , n = 13 mice; two-way ANOVA). c Representative confocal z-stack images showing astrocytic phagocytosis of corticostriatal presynapses in the DLS from control ( Megf10 fl/fl) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. d Quantification of corticostriatal presynapses by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 9 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 7 mice; one-way ANOVA). e Representative confocal z-stack images showing astrocytic phagocytosis of striatal postynapses in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. f Quantification of striatal postsynaptic phagocytosis by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 5 mice, 5 days: n = 4 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 8 mice, 5 days: n = 6 mice; one-way ANOVA). g Schematic illustration of the experiment to knock out Megf10 astrocytes conditionally in the striatum. h Latency to fall during the accelerating rotarod task of the control group <t>(</t> <t>GfaABC1D-Gfp</t> , green) and the Megf10 cKO group ( GfaABC1D-Cre , yellow) ( GfaABC1D-Gfp : n = 9 mice, GfaABC1D-Cre : n = 10 mice; two-way ANOVA). i A schematic illustration of the stimulation site in the corticostriatal pathway and the whole-cell patch-clamp recording in the DLS of a horizontal brain slice. Created in BioRender. Chung, W. (2026) https://BioRender.com/spxps4n . j Representative recording traces (left) and summary statistics (right) depicting the I/O relationships at corticostriatal excitatory synapses (Control, n = 19 cells from 5 mice; Megf10 cKO, n = 21 cells from 5 mice; RM two-way ANOVA). k Representative recording traces (left) and summary statistics (right) illustrating the AMPA/NMDA ratio at corticostriatal synapses (Control, n = 11 cells from 3 mice; Megf10 cKO, n = 11 cells from 4 mice; unpaired two-sided t -test). Data were presented as mean values ± SEM. AU arbitrary units.
    Paav Gfaabc1d Gfp Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pmc12929717-242-3-12?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    paav gfaabc1d gfp construct - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Addgene inc archaerhodopsin 3
    a An experimental scheme. b Latency to fall during rotarod training of control and Megf10 cKO (black: Megf10 fl/fl , n = 9 mice, red: Aldh1l1-CreERT2; Megf10 fl/fl , n = 13 mice; two-way ANOVA). c Representative confocal z-stack images showing astrocytic phagocytosis of corticostriatal presynapses in the DLS from control ( Megf10 fl/fl) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. d Quantification of corticostriatal presynapses by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 9 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 7 mice; one-way ANOVA). e Representative confocal z-stack images showing astrocytic phagocytosis of striatal postynapses in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. f Quantification of striatal postsynaptic phagocytosis by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 5 mice, 5 days: n = 4 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 8 mice, 5 days: n = 6 mice; one-way ANOVA). g Schematic illustration of the experiment to knock out Megf10 astrocytes conditionally in the striatum. h Latency to fall during the accelerating rotarod task of the control group <t>(</t> <t>GfaABC1D-Gfp</t> , green) and the Megf10 cKO group ( GfaABC1D-Cre , yellow) ( GfaABC1D-Gfp : n = 9 mice, GfaABC1D-Cre : n = 10 mice; two-way ANOVA). i A schematic illustration of the stimulation site in the corticostriatal pathway and the whole-cell patch-clamp recording in the DLS of a horizontal brain slice. Created in BioRender. Chung, W. (2026) https://BioRender.com/spxps4n . j Representative recording traces (left) and summary statistics (right) depicting the I/O relationships at corticostriatal excitatory synapses (Control, n = 19 cells from 5 mice; Megf10 cKO, n = 21 cells from 5 mice; RM two-way ANOVA). k Representative recording traces (left) and summary statistics (right) illustrating the AMPA/NMDA ratio at corticostriatal synapses (Control, n = 11 cells from 3 mice; Megf10 cKO, n = 11 cells from 4 mice; unpaired two-sided t -test). Data were presented as mean values ± SEM. AU arbitrary units.
    Archaerhodopsin 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav+gfp+plasmid/pmc12796580-437-2-6?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    archaerhodopsin 3 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Assessment of Futile Creatine Cycle within mature brown adipocytes (A) Representative immunofluorescence images of iBAT transduced with AAV-FLEX-GFP-FLAG. Mature adipocytes were labelled with anti-Perilipin 1 (PLIN1) antibody (red), GFP-FLAG was labeled with anti-FLAG antibody (green). Nuclei were labelled with DAPI (blue). Scale bar, 100 μm. Figure adapted from figure 1d of Bunk et al. (B) Oxygen consumption rates basally and following sequential additions of noradrenaline (NA, 0.1 μM) and oligomycin (Oligo, 15 μM). SBI-425 (10 μM) was added at the start (n = 2 independent preparations/sex). Figure adapted from figure 5b of Bunk et al. Two-way ANOVA (Tukey’s post-hoc test). Data are represented as mean ± SEM.

    Journal: STAR Protocols

    Article Title: Protocol for targeted gene manipulation and thermogenic evaluation in mouse brown adipocytes

    doi: 10.1016/j.xpro.2025.104317

    Figure Lengend Snippet: Assessment of Futile Creatine Cycle within mature brown adipocytes (A) Representative immunofluorescence images of iBAT transduced with AAV-FLEX-GFP-FLAG. Mature adipocytes were labelled with anti-Perilipin 1 (PLIN1) antibody (red), GFP-FLAG was labeled with anti-FLAG antibody (green). Nuclei were labelled with DAPI (blue). Scale bar, 100 μm. Figure adapted from figure 1d of Bunk et al. (B) Oxygen consumption rates basally and following sequential additions of noradrenaline (NA, 0.1 μM) and oligomycin (Oligo, 15 μM). SBI-425 (10 μM) was added at the start (n = 2 independent preparations/sex). Figure adapted from figure 5b of Bunk et al. Two-way ANOVA (Tukey’s post-hoc test). Data are represented as mean ± SEM.

    Article Snippet: AAV GFP (plasmid) , Addgene , 49055.

    Techniques: Immunofluorescence, Transduction, Labeling

    (A). Immunofluorescence (IF) images of in vivo AT2 transduction using AAV9. Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE (AAV-SBase-intron) system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.

    Journal: bioRxiv

    Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

    doi: 10.64898/2026.03.13.711474

    Figure Lengend Snippet: (A). Immunofluorescence (IF) images of in vivo AT2 transduction using AAV9. Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE (AAV-SBase-intron) system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.

    Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

    Techniques: Immunofluorescence, In Vivo, Transduction, Infection, Gene Knockout, Control, Expressing, Knock-Out

    (A). Two color AAV experiments for quantitative assessment of multi-infection rate for AAV transduction in vivo . Mice were i.t. administered non-engineered eGFP-AAV9: mCherry-AAV9 at 1:1 ratio at indicated total viral loads (4 × 10 9 , 2 × 10 10 , or 1 × 10 11 ) and lungs were harvested five days later. Representative gates were pregated as CD45 - CD31 - Pdgfra - EpCAM + CD104 - MHCII + . (B). Pairwise scatter plots of gRNA abundance in libraries from plasmids, AAVs, and AT2s from biological replicates. (C). Pearson correlation of gRNA abundance in the CM screen derived from plasmids (P), packaged AAV libraries (AAV), and AT2s harvested after injury resolution. Pairwise correlations demonstrate high library representation fidelity across stages. (D). gRNA abundance log 2 fold change (LFC) of control gRNAs and Plk1 gRNAs in the CM and TF screens. Error bars: mean ± SEM. Statistical analysis was using the two-tailed Student’s t -tests. p-values are reported as follows: **p < 0.01.

    Journal: bioRxiv

    Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

    doi: 10.64898/2026.03.13.711474

    Figure Lengend Snippet: (A). Two color AAV experiments for quantitative assessment of multi-infection rate for AAV transduction in vivo . Mice were i.t. administered non-engineered eGFP-AAV9: mCherry-AAV9 at 1:1 ratio at indicated total viral loads (4 × 10 9 , 2 × 10 10 , or 1 × 10 11 ) and lungs were harvested five days later. Representative gates were pregated as CD45 - CD31 - Pdgfra - EpCAM + CD104 - MHCII + . (B). Pairwise scatter plots of gRNA abundance in libraries from plasmids, AAVs, and AT2s from biological replicates. (C). Pearson correlation of gRNA abundance in the CM screen derived from plasmids (P), packaged AAV libraries (AAV), and AT2s harvested after injury resolution. Pairwise correlations demonstrate high library representation fidelity across stages. (D). gRNA abundance log 2 fold change (LFC) of control gRNAs and Plk1 gRNAs in the CM and TF screens. Error bars: mean ± SEM. Statistical analysis was using the two-tailed Student’s t -tests. p-values are reported as follows: **p < 0.01.

    Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

    Techniques: Infection, Transduction, In Vivo, Derivative Assay, Control, Two Tailed Test

    a An experimental scheme. b Latency to fall during rotarod training of control and Megf10 cKO (black: Megf10 fl/fl , n = 9 mice, red: Aldh1l1-CreERT2; Megf10 fl/fl , n = 13 mice; two-way ANOVA). c Representative confocal z-stack images showing astrocytic phagocytosis of corticostriatal presynapses in the DLS from control ( Megf10 fl/fl) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. d Quantification of corticostriatal presynapses by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 9 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 7 mice; one-way ANOVA). e Representative confocal z-stack images showing astrocytic phagocytosis of striatal postynapses in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. f Quantification of striatal postsynaptic phagocytosis by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 5 mice, 5 days: n = 4 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 8 mice, 5 days: n = 6 mice; one-way ANOVA). g Schematic illustration of the experiment to knock out Megf10 astrocytes conditionally in the striatum. h Latency to fall during the accelerating rotarod task of the control group ( GfaABC1D-Gfp , green) and the Megf10 cKO group ( GfaABC1D-Cre , yellow) ( GfaABC1D-Gfp : n = 9 mice, GfaABC1D-Cre : n = 10 mice; two-way ANOVA). i A schematic illustration of the stimulation site in the corticostriatal pathway and the whole-cell patch-clamp recording in the DLS of a horizontal brain slice. Created in BioRender. Chung, W. (2026) https://BioRender.com/spxps4n . j Representative recording traces (left) and summary statistics (right) depicting the I/O relationships at corticostriatal excitatory synapses (Control, n = 19 cells from 5 mice; Megf10 cKO, n = 21 cells from 5 mice; RM two-way ANOVA). k Representative recording traces (left) and summary statistics (right) illustrating the AMPA/NMDA ratio at corticostriatal synapses (Control, n = 11 cells from 3 mice; Megf10 cKO, n = 11 cells from 4 mice; unpaired two-sided t -test). Data were presented as mean values ± SEM. AU arbitrary units.

    Journal: Nature Communications

    Article Title: Motor learning and dopamine-dependent striatal synaptic plasticity are controlled by astrocytic MEGF10

    doi: 10.1038/s41467-026-69129-1

    Figure Lengend Snippet: a An experimental scheme. b Latency to fall during rotarod training of control and Megf10 cKO (black: Megf10 fl/fl , n = 9 mice, red: Aldh1l1-CreERT2; Megf10 fl/fl , n = 13 mice; two-way ANOVA). c Representative confocal z-stack images showing astrocytic phagocytosis of corticostriatal presynapses in the DLS from control ( Megf10 fl/fl) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. d Quantification of corticostriatal presynapses by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 9 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 7 mice; one-way ANOVA). e Representative confocal z-stack images showing astrocytic phagocytosis of striatal postynapses in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. f Quantification of striatal postsynaptic phagocytosis by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 5 mice, 5 days: n = 4 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 8 mice, 5 days: n = 6 mice; one-way ANOVA). g Schematic illustration of the experiment to knock out Megf10 astrocytes conditionally in the striatum. h Latency to fall during the accelerating rotarod task of the control group ( GfaABC1D-Gfp , green) and the Megf10 cKO group ( GfaABC1D-Cre , yellow) ( GfaABC1D-Gfp : n = 9 mice, GfaABC1D-Cre : n = 10 mice; two-way ANOVA). i A schematic illustration of the stimulation site in the corticostriatal pathway and the whole-cell patch-clamp recording in the DLS of a horizontal brain slice. Created in BioRender. Chung, W. (2026) https://BioRender.com/spxps4n . j Representative recording traces (left) and summary statistics (right) depicting the I/O relationships at corticostriatal excitatory synapses (Control, n = 19 cells from 5 mice; Megf10 cKO, n = 21 cells from 5 mice; RM two-way ANOVA). k Representative recording traces (left) and summary statistics (right) illustrating the AMPA/NMDA ratio at corticostriatal synapses (Control, n = 11 cells from 3 mice; Megf10 cKO, n = 11 cells from 4 mice; unpaired two-sided t -test). Data were presented as mean values ± SEM. AU arbitrary units.

    Article Snippet: To generate the pAAV- GfaABC1D-GFP construct, the eGFP construct from pAAV- CAG-GFP (Addgene #28014) were amplified by PCR and subcloned into pAAV- GfaABC1D-Cre (Addgene #1056063).

    Techniques: Control, Knock-Out, Patch Clamp, Slice Preparation